Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290435
Clone ID OST290435
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290435
Sequence
GACTGAGAGCACCTGAGTAGCCAACTGTGGGGTTTGAAGACACCACCAGCCCTCGGAAAGGATGTTCTGACCATCCCTCC
AAATCAGCAGATGCCCATGGAAGAATTCTGTGTTCTACAAGAAGACCCAGATGAATTTTTATTTAAGTAGAACACCTTTG
TCTTATTTATACAAATTAAAGCAAATTTTCATATTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 34969652..34969774 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002635 (Pdcd2l) NM_026549 programmed cell death 2-like Gene [Source:MGI (curated);Acc:Pdcd2l-001]

 
Come back to gene ENSMUSG00000002635


For any suggestions or comments, please send an email to unitrap@crg.es