Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290392
Clone ID OST290392
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290392
Sequence
GACTGAGGTCTCTTACCTTCATTAACTGTGCCTATGTCAAGTGGGGAACCCTGGTCCAAGATATTTTCACCTACGCTAAG
GTGTTGGCGCTGATTGCAGTCATCATTGCAGGCATTGTTAGACTTG
Sequence Type mRNA
Unitrap ID UNI13165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 54998790..54998911 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000958 (Slc7a7) NM_011405 solute carrier family 7 (cationic amino acid transporter, y+ system), member 7 Gene [Source:MGI Symbol;Acc:MGI:1337120]

 
Come back to gene ENSMUSG00000000958


For any suggestions or comments, please send an email to unitrap@crg.es