Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290290
Clone ID OST290290
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290290
Sequence
CAACTCAGCGGAAAAGTGGGGACACCCCTTAGTGTTCGAAAAACTAAAGGAANTGGCCAAAGCAGAGGGCCTGTGGAATT
TGTTCTTGCCAGCTGTGAGCGGTCTCAGCCAGGTGGACTATGCCTTGATTGCTGAAGAGACAGGAAAATGCCTTTTTTGC
TCCAGATGTTTTTAACTGCCAAGCACCAGACTTTTNCAACATGGAGGTACCTGCACCTGTATGGCAGCGAGCAGCANAAG
AAGCAGTGGCTGGAGCCTCTCCTGCGTGGCGATATCACCTCCGTCTTCTGTATGACAGAGCCCAACGTCTCATCAAGCGA
TGCCACGAACATCGAATGCACCATCCAGAGAGATGGAGGTGGCTATATAGTTAACGGCAAGAAGTGGTGGAGCAGCGGAG
CTGGGAATCCCAAGTGCAAAATCGCCATTGTTTTGGGAAGAATGGAGTCTNCCTCTGCATCCAGACACAG
Sequence Type mRNA
Unitrap ID UNI22609

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103992618..104015858 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032558 (Acad11) NM_175324 nephronophthisis 3 (adolescent) Gene [Source:MGI (curated);Acc:Nphp3-001]

 
Come back to gene ENSMUSG00000032558


For any suggestions or comments, please send an email to unitrap@crg.es