Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290260
Clone ID OST290260
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290260
Sequence
CTTCCGAAAGGGTGACATCATGACAGTGCTCGAGCGGGACACTCAGGGCCTGGATGGCTGGTGGCTCTGCTCACTGCATG
GGCGCCAGGGCATTGTGCCTGGTAACCCGCCTCAAGATTCTGGTTGGCATGTATGATAAGAAGCCAGTAGGACCTGGACC
AGGCCCACCTGCCACCCCACCCCAGCCCCAGCCCAGCCTTCCCCAGGGCGTCCATGCTCCAGGTACCTCCAGCTTCCCAG
TACAGTCCCATGCTCCCCACTGCGTACCAGCCCCAGTCTGACAATGTGTACCTGGTACCCACTCCCAGCAAGACTCANCA
AGGTCTNTACCAANCCCCTGGAGCCAACCCACAGNTTCAGTCACCCCCAGCCAAACAGACGTTCCACATTCTNCAAGCAA
ACACCTNATCACTNATTTTCCCAGCCCAGCCACGGGACCCTTTAC
Sequence Type mRNA
Unitrap ID UNI22251

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114244737..114245175 401
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031955 (Bcar1) NP_034084 breast cancer anti-estrogen resistance 1 Gene [Source:MGI Symbol;Acc:MGI:108091]

 
Come back to gene ENSMUSG00000031955


For any suggestions or comments, please send an email to unitrap@crg.es