Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290128
Clone ID OST290128
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290128
Sequence
TGAGGTTGCTCCGAGGAGATGCCGTGGTGGAGCTGGGCTTCAACGATTACCTAGACATCTTCTGCCCACATTATGAAAGC
CCAGGGCCCCCAGAAGGCCCGGAAACCTTTGCATTATACATGGTGGACTGGTCAGGCTACGAGGCCTGCACGGCAGAGGG
GGCAAATGCCTTCCAGCGCTGGAATTGCTCGATGCCTTTTGCCCCTTTCAGCCCTGTTCGATTCTCAGAAAAGATTCAGC
GCTACACACCCTTCCCGCTGGGCTTTGAGTTCTTGCCTGGAGAGACTTACTACTACATCTCGGTGCCGACTCCGGAGAGT
CCTGGCCGGTGCCTGAGACTCCAGGTGTCTGTCTGCTGCAAGGAGAGCGGGTCATCACATGAGTCAGCTCATCCTGTTGG
GAGTCCTGGAGAAAGCGGTACGTCCGGGTGGCGGGGAGGACACGCGCCCAGCCCCCTGTGTCTCTTGCTGCTGCTGCTGC
T
Sequence Type mRNA
Unitrap ID UNI20606

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 89138243..89139396 298
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028040 (Efna4) NM_007910 ephrin A4 Gene [Source:MGI (curated);Acc:Efna4-001]

 
Come back to gene ENSMUSG00000028040


For any suggestions or comments, please send an email to unitrap@crg.es