Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290040
Clone ID OST290040
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290040
Sequence
GAGGAGTCTGTGAAGTTTGAAGATGTATCTCTGNCATTTACCGAGGAAGAGTGGGCACAGCTGGACTTCCAACAGAAGTG
CCTGTACAGGGAGATCATGATGGAGAACTACAGCAACATGATTTCAGTGGGT
Sequence Type mRNA
Unitrap ID UNI22613

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13421640..13421770 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058638 (Zfp110) NM_022981 zinc finger protein 110 Gene [Source:MGI (curated);Acc:Zfp110-001]

 
Come back to gene ENSMUSG00000058638


For any suggestions or comments, please send an email to unitrap@crg.es