Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST290038
Clone ID OST290038
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST290038
Sequence
GACTGAGGAATTTAAGTCATCCAGNTTAAGGAGAATGAATCTCGTCATTTTCCACTTTGATGCATAAGTTTCCCTGACGT
GTCCTTGGAATCGCAGAAGAATTTGGTCACATATTTTACCATCAGACTAAAGAGATGGACTTGACTAGTTTGTCCTGTGA
AAGTCTGCTTTCTGGTGACCAGAACTGCAGTCAAGGAGAAGAGACAGAGGGAGAAAGCATGCCTGGCTGATTGCCTGAAA
AACTGTAATAANGATGAGGCTGNGGATTTCTCTGAAGAGGAGTGGACTACAAAGGCTCCAACTCAGAACAGCAAGTCTGG
TGCTGTGGCGGTGGAGGAGCACACAAGCCTGGCCGCTGTAGAATTGGAAAAGCAACTACAAACCAAAGATTTAGCACCAG
AGCAGGATTTTTTGACAAGACACACCTTCATGGAGACACAGCAGGTGGATGCAGTGACCTTTGAAGATGTGGCTGTGGAC
TTTACCCAGG
Sequence Type mRNA
Unitrap ID UNI22614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20245857..20250343 155
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063108 (Zfp26) NM_011753 zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]

 
Come back to gene ENSMUSG00000063108


For any suggestions or comments, please send an email to unitrap@crg.es