Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0009
Clone ID XT0009
Vector pGT0lxf
Project sanger

Sequence tag XT0009
Sequence
AAGCTCTTCTAGATAGTGGTTGTGAGCTCTTCTAGATGGTTTTTTGGCGTCCGTGTGCTCCGTGCGGGCGGAGCGAACAA
AGACCGGGCCAGAGGAGCCAGACGCCCAGATCCCTCTCGCTGCGTTTCCCCAAAATAGTTCTGGAATCATGCCTGAAATG
CCGGAGGCCATGGAACAG
Sequence Type mRNA
Unitrap ID UNI4851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40508305..40508442 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042032 (Mat2b) NM_134017 methionine adenosyltransferase II, beta Gene [Source:MGI (curated);Acc:Mat2b-001]

 
Come back to gene ENSMUSG00000042032


For any suggestions or comments, please send an email to unitrap@crg.es