Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST289498
Clone ID OST289498
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST289498
Sequence
GACTGAGGTAAATTTAACACAATGTTATTTCTCCAAGCTACCCAAAATCCGAGATGAGGATAAAGAAAGTACATTTGGTT
ATGTGCATGGAGTCTCAGGGCCTGTGGTTACAGCCTGTGACATGGCGGGCGCTGCCATGTACGAGCTGGTGAGAG
Sequence Type mRNA
Unitrap ID UNI22635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 44114805..44117000 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052459 (Atp6v1a) NM_007508 ATPase, H+ transporting, lysosomal V1 subunit A Gene [Source:MGI (curated);Acc:Atp6v1a-001]

 
Come back to gene ENSMUSG00000052459


For any suggestions or comments, please send an email to unitrap@crg.es