Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST289214
Clone ID OST289214
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST289214
Sequence
CTGAGCTCCAGCACCAGTCAGCAAAGTGAATAAGNNCTGTGCTGCCGCCGCTTCCACCTTCCACTCCACTCCGGGAAGAA
AGAGCCGCCATCATGTCAAGCATCACNGATTGACCCGGATGTCAAGCCCGGTGAATATGTCATCAAGAGTCTCTTTGCAG
AATTTGCTGTTCAAGCTGAAAAGAAAATTGAAGTTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16475

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73539270..73539463 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es