Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST289131
Clone ID OST289131
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST289131
Sequence
GAACTGAGGACCTGAAAGAAAAGAAGGNCAAGGCTGGAGGANAAGGCCGGCCGTAAAGAACGGAANAANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCGTGCGGAAGAGAACTGCTGAAGAGGAGGATGAAGCAGACCCCAAGAGG
CAGAAGACAGAAAACGGGGCGTCGGCATGAACCCCTGCCCGTGGGCTTGGGGATGGGAGGCCCCTCAGGTCCTGGAGGTG
GGGCGGGAACACACAAATCCAGCCCCCTTTCTCCTGGCTCCCTGCTCTGGCCCTGCCCCAGAGCTGTGACCCTTGTCCTT
TGACCCAGCCTCTCATTTCCATCTCTCCAGACACTGCTCCTTCACCCTCACTGCCACCGGTCCAGCTCCTGACCCGCCTC
ATCTGAGCTCCCCCAGCCAGCCCT
Sequence Type mRNA
Unitrap ID UNI22644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124863967..124865009 283
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030122 (Ptms) NM_026988 parathymosin Gene [Source:MGI (curated);Acc:Ptms-001]

 
Come back to gene ENSMUSG00000030122


For any suggestions or comments, please send an email to unitrap@crg.es