Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288964
Clone ID OST288964
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288964
Sequence
CCTGCCTCCCCTTTTGCCTGANAANANAAGCCAGACTGAAAAGATTGAGAAGCACGGACTCNAACCAGTTCCAAAACTCC
TGTAGAACTGAACGGTCTTTGTAATGGCAGACAGCAGCTACAAGCCCATCGNGGAATNCATTGATGCTCAGNTTGAGGCC
TACCTACAAGAGGAGCTGAANATCCGAANAGTACGTGCACTCCTACCATGACTCCCGAATNNTTTGTCTGCTTGTATTTC
ATTGCCCCGACAGGACATTCGGTTAAGTCTCTGGACCTAGTGACCATGAAGAAGCTGGATAGTAAGGTATGAGACAACTG
CTGGGGCTCCACAGGCTGGACTCTTCCTCATCTAATACACAATGGCTCCTGGATTCCAGTAGAGGTCTTATGGAATCCTA
ATCCAATTCTTTGTTACCGTCCTTCATAAAGATGATATTACAGATGCCTGCATTTGGGTCATATGCTGTGTCATCTGGAT
TCCNAGTATTAGGGATGGAT
Sequence Type mRNA
Unitrap ID UNI22651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34486369..34531786 357
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050379 (Sept6) NM_019942 septin 6 Gene [Source:MGI (curated);Acc:Sept6-003]

 
Come back to gene ENSMUSG00000050379


For any suggestions or comments, please send an email to unitrap@crg.es