Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288897
Clone ID OST288897
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288897
Sequence
CCTTCTTGCGTGGGCACNATTGNGTCAGCTAGGNGATAAGNCTGNTCTNNACNTGGACCATGTGGACCANCTGGTAAACC
AAGGCACTCCAGAGCCAACCGAACACCCCCATCCATCAGGGGGCAATGATGACAAGGCTGAAGAGACCAGTGACAGTGGG
GGAGACGCCACTGGAGAACCTGGAGCTAGGGGAGAGATGGAGCCCAGCCTGGAGCATCTCCTGGACATCCAAGGCCTGCC
TAAAAGGCAAGCAGGCCTGGGGAGCAGTCGCCCAGAAGCCCCGCTGGGGTTAGATGATGGCTCCTGCCTCTCTCCCAGCC
CCAGCCTCATCAATGTTCGCCTC
Sequence Type mRNA
Unitrap ID UNI22653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102148786..102149117 305
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034757 (Tmub2) NM_028076 transmembrane and ubiquitin-like domain containing 2 Gene [Source:MGI (curated);Acc:Tmub2-002]

 
Come back to gene ENSMUSG00000034757


For any suggestions or comments, please send an email to unitrap@crg.es