Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288723
Clone ID OST288723
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288723
Sequence
CATTGGTCTCACAGCACCAGCAGTTATTGGAGATGTCCTTCAGGTCTNCAGTGGGTCTGAAGGGAGAGCTATTATCTTCT
GTGAAACTAAGAAGAATGTTACTNGAAATGGCCATGAATCCACACATAAAGCAGAATGCTCAGTGTTTGCATGGAGACAT
TGCACAGTCACAAAGAGAAATTACCTTGAAAGGCCTTCAGAGAAGGTNNTTTTAAAGTTTTGGTAGCAACCAATGTGGCT
GCTCGTGGCTTGGACATTCCTGAGGTTGACCTAGNGATTCAGAGTTCTCCTCCACAGGANGTTGAATCCTATATCCATCG
CTCTGGACGCACAGGTAGAGCTGGCNCGGACAGGAATNTGTGTATGTTTTTATCAACCAAGGGAAAGAGGTCAACTGAGA
TATGTGGAGCAGAAAGCTGGAATTACCTTNNAAACGTGTAGGTGTTCCGTCTACAANGGATTTAGNTAAATCTNAAAGCA
TGGATGCCATCAGG
Sequence Type mRNA
Unitrap ID UNI8481

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62087892..62096856 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020076 (Ddx50) NM_053183 DEAD (Asp-Glu-Ala-Asp) box polypeptide 50 Gene [Source:MGI Symbol;Acc:MGI:2182303]

 
Come back to gene ENSMUSG00000020076


For any suggestions or comments, please send an email to unitrap@crg.es