Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288673
Clone ID OST288673
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288673
Sequence
TGAGGTACAAAGGGAGGCCCNAGGCCGAGTGAGGCAGTATACGAGCCCGGAGGAGATCGATGCCCAGCTACAGGCTGAGA
AGCAGAAGGCCAACGAAGAAGATGAACAAGAAGAAGGTGGAGATGGGGCTTCAGGTGACCCAAAAAAGGAAAAGAAATCT
CTAGACTCAGATGAAAGTGAAGATGAAGATGATGACTACCAGCAAAAGCGAAAAGGCGTGGAGGGGCTCATTGACATTGA
GAACCCCAACCGCGTGGCACAGACAACTAAGAAGGTCACGCAACTGGATCTGGACGGGCCAAAGGAGCTTTCAAGGAGAG
AAAGAGAAGAAATAGAGAAGCAAAAAGCAAAAGAACGCTACATGAAGATGCATTTGGCTGGGAAGACAGAGCAGGCCAAG
GCTGATCTCGCCCGGCTGGCAATCATCCGGAAACAGCGGGAGGAGGCAGCAAGAAAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI22661

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 145892250..145897864 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029623 (Pdap1) NM_001033313 PDGFA associated protein 1 Gene [Source:MGI (curated);Acc:Pdap1-001]

 
Come back to gene ENSMUSG00000029623


For any suggestions or comments, please send an email to unitrap@crg.es