Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288644
Clone ID OST288644
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288644
Sequence
GACTGAGTTCGCCATGGATGACGATATCGCTGCGCTGGTCGTCGACAACGGCTCCGGCATGTGCAAAGCCGGCTTCGCGG
GCGACGATGCTCCCCGGGCTGTATTCCCCTCCATCGTGGGCCGCCCTAGGCACCAGGGTGTGATGGTGGGAATGGGTCAG
AAGGACTCCTATGTGGGTGACGAGGCCCAGAGCAAGAGAGGTATCCTGACCCTGAAGTACCCCATTGAACATGGCATTGT
TACCAACTGGGACGACATGGAGAAGATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCCCCTGAGGAGCACCCTG
TGCTGCTCACCGAGGCCCCCCTGAACCCTAAGGCCAACCGTGAAAAGATGACCCAGATCATGTTTGAGACCTTCAACACC
CCAGCCATGTACGTAGCCATCCAGGCTGTGCTGTCCCTGTATGCCTCTGGTCGTACCACAGGCATTGTGATGGACTCCGG
AGACGGGGTCACCCACACTGTGCCCATCTACG
Sequence Type mRNA
Unitrap ID UNI3488

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143666326..143667373 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029580 (Actb) NM_007393 actin, beta Gene [Source:MGI Symbol;Acc:MGI:87904]

 
Come back to gene ENSMUSG00000029580


For any suggestions or comments, please send an email to unitrap@crg.es