Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288594
Clone ID OST288594
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288594
Sequence
ACTGAGGCGGAGCAGAGTATCCAGCATGCTGTCCCGACGCCTTGGTAAGCGCTCCCTCTTGGGAGCCCGGGTGTTGGGAC
CTANTGCCGCTGAAGTACCATCANGGGCCACCCTGCCTCTGGAGCCACAGATAGAAGTGCCGGAAGGAGCCATGTCCCTG
TCCCCACTCACCTCTAAGGACCCTGTGTGCCAGGAGCAGCCCAAGGAGCTCCTCAAAGCTCTGGGAACCTCAGGCCACCC
ACAGGTGGCCTTTCAGCCTGGACAGAAGGTCTGTGTGTGGTATGGAGGTCAGGAGTGCAAGGGCCTGGTGGAGCAGCACA
GCTGGGCCGAGGACAAGGTGACCGTCCGGCTGCTGGACCANAAGTTACAGATTCGCTGTAAAGTGGAAGAGGNGTGGCTG
GCGGAGCTGCAGGGTAGCGCATCCCACGTGCCAGCCTTGGAGCCCGGAGCCCAGGTGCCAGCCTACAGACCGGTGTCTAG
GAACATCGACGTCCCGAAGACATA
Sequence Type mRNA
Unitrap ID UNI22374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 66004234..66005395 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034522 (Zfp395) NP_950194 zinc finger protein 395 Gene [Source:MGI Symbol;Acc:MGI:2682318]

 
Come back to gene ENSMUSG00000034522


For any suggestions or comments, please send an email to unitrap@crg.es