Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AK0793
Clone ID AK0793
Vector pGT0lxr
Project sanger

Sequence tag AK0793
Sequence
GTTGTGAGCTCTTCTAGATGGAGGAGATGGAACTGACGCTCGTGGGGCTGCAGTACTCCGGCAAGACCACCTTCGTCAAT
GTCATCGCG
Sequence Type mRNA
Unitrap ID UNI4725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108733290..108733371 78
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030105 (Arl8b) NM_026011 ADP-ribosylation factor-like 8B Gene [Source:MGI Symbol;Acc:MGI:1914416]

 
Come back to gene ENSMUSG00000030105


For any suggestions or comments, please send an email to unitrap@crg.es