Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288406
Clone ID OST288406
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288406
Sequence
GACTGAGTTGTGAAAATGTCCCAGAGGAGGGTTTGGCGGTACCAGCAGCAGTGATGCCCAGCAAAGCCTCCAGTCCTTCT
GGCCCAGAGTCATGGAAGAAATCCGAAACTTAACAGTGAAAGATTTCCGAGTACAGGAACTCCCACTGGCTCGTATTAAG
AAGATTATGAAACTGGATGAAGATGTGAAGATGATCAGTGCNGAAGCCCCTGTGCTGTTTGCTAAGGCAGCCCAGATTTT
TATCACTGAGCTGACTCTTCGAGCCTGGATCCACACAGAGGATAACAAGCGTCGTACTCTTCAGAGGAATGATATTGCCA
TGGCAATTACAAAATTTGATCAGTTCGACTTTCTCATCGATATTGTTCCAAGAGATGAACTGAAACCTCCAAAGCGCCAG
GAGGAGGTACGCCAGTCTGTGACTCCTGCGGAGCCTGTCCAGTACTACTTCACGCTGGCTCAGCAGCCCACTGCTGTCCA
GGTCCAGGGACAGCAGCAAGGCCAG
Sequence Type mRNA
Unitrap ID UNI13526

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 120441400..120463096 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032897 (Nfyc) NM_008692 nuclear transcription factor-Y gamma Gene [Source:MGI (curated);Acc:Nfyc-002]

 
Come back to gene ENSMUSG00000032897


For any suggestions or comments, please send an email to unitrap@crg.es