Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AT0180
Clone ID AT0180
Vector pGT0lxr
Project sanger

Sequence tag AT0180
Sequence
GCAGAACCTGAAAGGGAGATTCTGGACGGTCCCGGGGACTCTAGACTGTCTGTCCCACGACCTGTTCTTGGCGTTATG
Sequence Type mRNA
Unitrap ID UNI4900

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 84361962..84362039 76
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035762 (Tmem161b) NM_175187 transmembrane protein 161B Gene [Source:MGI Symbol;Acc:MGI:1919995]

 
Come back to gene ENSMUSG00000035762


For any suggestions or comments, please send an email to unitrap@crg.es