Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST288111
Clone ID OST288111
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST288111
Sequence
AGAATTAGGAGAACCATAAACAGAGGAAACAGCCCTTTCCCCATCTTAGCTGTGGTTCCCGGGAAGTAGTTTTTGTAAAC
AGAAACCATGTTTTTTCATATCTGTTATTCCTATAAACAAT
Sequence Type mRNA
Unitrap ID UNI22678

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 113493589..113493709 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031749 (St3gal2) NM_009179 ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene [Source:MGI (curated);Acc:St3gal2-001]

 
Come back to gene ENSMUSG00000031749


For any suggestions or comments, please send an email to unitrap@crg.es