Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST287841
Clone ID OST287841
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST287841
Sequence
ACTGAGGCAGAGGTGGAGGAAACACTCAAGNGGCTTCAGAGCCAGAAAGGAGTGCAGGGCATCATCGTGGTGAACACAGA
AGGCATTCCCATCAAGAGCACAATGGACAATCCCACCACTACACAGTATGCCAACCTCATGCACAACTTCATCTTGAAGG
CGCGGAGCACTGTGCGTGAGATTGACCCCCAAAACGACCTAACCTTCCTTCGAATTCGCTCCAAGAAAAATGAAATTATG
GTGGCACCAGATAAAGACTATTTCCTGATTGTGATCCAGAATCCAACTGAATAAGCCACTGTCTGGGCTTCCCGTGTCAT
TCCTTAATTTAATGTCCCCCAAGAATAATAGTGCTAATCATGTCAGTGGGCACGTGGTGGCCACCTGAGCCCGTGTAGAC
CATGCCATTGATCAAGGGTCGCTCTGCCCACCCCACAAGGAGTGCCTCTGATCCAGTCAGCCCCTGGGGAATCAGTTCGC
CCTTGCAGGCTTTGGAATGCCA
Sequence Type mRNA
Unitrap ID UNI6131

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 155068465..155075905 249
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047459 (Dynlrb1) NM_025947 dynein light chain roadblock-type 1 Gene [Source:MGI (curated);Acc:Dynlrb1-001]

 
Come back to gene ENSMUSG00000047459


For any suggestions or comments, please send an email to unitrap@crg.es