Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST287668
Clone ID OST287668
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST287668
Sequence
GACTGAGGGGGCAGCNCGAGCCGTTCCTGTCCTCATCATAGGCATTTTGGTGTTCCTACCGGGATTTTACCATTTGCGCA
TCGCCTATTATGCATCCAAGGGCTACCGGGGTTACTCCTACGATGACATTCCAGACTTTGATGACTAGCCTTCGCCTCAG
CCTTGAGAAGAGTCGCACACAGTGCAACCACNTTTAAGACATCAAGCAAGAACCTCTGGCTAAGGGCTGAAGAAGTCTAC
AATTTGCAGATGTTTAGCAAAACAATGGCCAGATTGTATGAGTCCTTCTCCAAAACGCTCCTGCTTTATAATTAGCTAAT
TAGGACATGGTATGTTTTCATCTCCTGGCCCTGGCTAAACTTGACAAGTTTTTCCACATGAGTGTGCATCATGTAAGAGT
TGTGAAGCTAACTGTCTGGGAAGGCAGCCTGTTCTATAGCAGAAGGNGTTACCCTCCTTAGAGCTGAACCTTTCTTTTGT
CTTCCATTTGNCTGCTTGGTTTTGNANCATAATGGGAAAATGAG
Sequence Type mRNA
Unitrap ID UNI22693

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132065854..132066364 486
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027341 (5730494N06Rik) NM_027478 RIKEN cDNA 5730494N06 gene Gene [Source:MGI Symbol;Acc:MGI:1917862]

 
Come back to gene ENSMUSG00000027341


For any suggestions or comments, please send an email to unitrap@crg.es