Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST287493
Clone ID OST287493
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST287493
Sequence
CTGAGCCTCACAGTCCAGTACATCCGAGGGTGTACGCCCAACAGCCGCTTCTGAGGCCCGTTTGAAAGCCTTGGCTGTTT
GCCACGGGCCTCTGGACCACTACGACTTTCTGATCAAATCTCAGGAGCTGAGGGAGGATGAACATCAAAGAAGAGTCTGT
TCAGTGTTTGCAGAAGTTACAGGAGGACCTTAAAGGATACAGCATAGAGGAAGGAGGGCTCTTTTCAAAGGTACAGGAAA
NNCACTGGCTGATGGACATGTTTTATGCATATGNGGAANCGAAGAGAAAGAAGCG
Sequence Type mRNA
Unitrap ID UNI19146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 42146330..42174338 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038302 (Lace1) NM_145743 lactation elevated 1 Gene [Source:MGI (curated);Acc:Lace1-001]

 
Come back to gene ENSMUSG00000038302


For any suggestions or comments, please send an email to unitrap@crg.es