Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST287488
Clone ID OST287488
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST287488
Sequence
CTGAGGGTTAGGAGACTAACTGANACACTGCCTGACAGCAGCTGAGCCAGTCCCCAATGTGACCACTGTAACCACTGCCA
TGCCTGAGCCCAGAAGACAGAACGACGCGCTGGAAGACACCAGAAGGCCACACAATAAAGAGCTCTTTCCTTCCACGTGA
TCTGAGTGTCGGCACCAGTGGGCAGGCTCTTGCTCTGCAGATTAACACGCAGTCTCCGTGGGGAAGAGAAGAGGGGATAG
CGTCGGGTCAGCACGGAGGAGCTGGGATGCCATTGCTCATAGGTCAACATGAATCCTGGGTTCTGCAGGCTGGCATCTGC
GGGCCTGGGTCTCTCTGGTGTCCTCAGGCCATGCCCAGGAGCTCACAGTTCCTGCAGAGCCTTCTTGGGACAGCCATTCT
GAGGCAGGGAGCTACCAGGCTGGGTTCCCAGGGGAACTTGTTGCAGGTAAGACGCTGGGGACCAAAGCTGCGGACCCATC
ATAGCTGACCTGATGA
Sequence Type mRNA
Unitrap ID UNI22699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115679215..115679704 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059900 (Tmem40) NM_144805 transmembrane protein 40 Gene [Source:MGI (curated);Acc:Tmem40-001]

 
Come back to gene ENSMUSG00000059900


For any suggestions or comments, please send an email to unitrap@crg.es