Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286723
Clone ID OST286723
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286723
Sequence
CACCGGCATGAGGGCACCATCCAGGTGCCGGGCCAGAACCTCTTCTTCAGAGAGACCCGNCCTGGGAGTGGGCAGCCTGT
CCGCTTCTCTGTGCTGCTGCTGCATGGTATCCGCTTCTCCTCGGAGACCTGGCAGAACCTGGGTACTCTGCANAGGCTGG
CTGAGGCTGGCNTACAGGGCTTGTGGCCATTGATCTGNCAGGTCTTGGGCGATCCAAGGAAGCANCAGCCCCTGCCCCTA
TTGGGGAACCGGCCCCTGGCAGCTTCCTAGCTGCTGTGGTGGATACCTTGGAGCTGGGACCCCCAGTTGTGATCAGTCCA
TCATTAAGTGGCATGTATTCACTGCCCTTCCTCGTGGCCCCCGGGTCCCAACTCCGGGGCTTTGTACCAGTGGCTCCTAT
CTGCACAGACANAATCAATGCTGTGGACTACGCCAGTGTGAANACTCCAGCTCTCATTGTATATGGAGACCAGGACCCCA
T
Sequence Type mRNA
Unitrap ID UNI22683

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106352365..106354352 240
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042073 (Abhd14b) NM_029631 abhydrolase domain containing 14b Gene [Source:MGI Symbol;Acc:MGI:1923741]

 
Come back to gene ENSMUSG00000042073


For any suggestions or comments, please send an email to unitrap@crg.es