Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286631
Clone ID OST286631
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286631
Sequence
GACTGAGTTTTTCCTGGTTTGGCTTGGNTATTGGAGGAACCTTGGTCAAGCTGGTTTATTTTGAACCTAAAGACATCACT
GCTGAAGAAGAAAAGGAGGAAGTGGAGAGTCTGAAAAGCATCCGGAAGTACCTGACCTCCAATGTGGCTTACGGATCCAC
AGGCATTCGGGACGTGCACCTTGAGCNTGAAGGACCTGACTCTGTGTGGACGCAAAGGCAATCTGCNCTTTATACGCTTT
CCCACCCATGACATGCCTGCTTTTATTCAGATGGGCAGAGATAAAAACTTCTCAAGTCTCCACACTGTCTTTTGTGCCAC
TGNAGGTGGATCATACAAATTTGAGCAGGATTTTCTCACANTATGCATCTTTTANCTTATATACAATTTATGGANATTTG
ATGTTTAAAATGATGCCC
Sequence Type mRNA
Unitrap ID UNI19997

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 131099645..131100056 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037514 (Pank2) NM_153501 pantothenate kinase 2 (Hallervorden-Spatz syndrome) Gene [Source:MGI (curated);Acc:Pank2-001]

 
Come back to gene ENSMUSG00000037514


For any suggestions or comments, please send an email to unitrap@crg.es