Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AR0079
Clone ID AR0079
Vector pGT0lxr
Project sanger

Sequence tag AR0079
Sequence
AATATTTGTGTATTTGACCAGGTGTAAACATAGATACATTTGTATCCAGTCATCTCTTGCAAAAGTATCCTCAAAAAAAG
TAAATGAGAAGGAAGTTGATAAGTTTCAGCTTTACCAGAATTTCTCCTGCAACATAAGGACCATCCACCATCACCAG
Sequence Type mRNA
Unitrap ID UNI4914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 86519254..86519410 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024135 (Srbd1) S1 RNA binding domain 1 Gene [Source:MGI Symbol;Acc:MGI:1925836]

 
Come back to gene ENSMUSG00000024135


For any suggestions or comments, please send an email to unitrap@crg.es