Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286487
Clone ID OST286487
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286487
Sequence
GACTGAGTACATCGGCATCATGTGGNTCCAGGTTCGAACTATGGATGGGAAGGAGACCCACACCGTGAACTCTCTGTCCA
GGTTGACCAAGGTGCAGGAGCTGAGGAAAAAGATTGAGGAAGTGTTTCACGTGGAACCCCAACTACAGAGACTCTTTTAT
AGGGGCAAACAGATGGAGGATGGCCACACACTCTTCGATTATGATGTGCGCCTCAATGACACAATCCAGCTGCTCGTGCG
CCAGAGTCTGGCACTGCCTCTCAGTACAAAAGAACGGGACTCGGAGCTCTCAGACTCTGACTCTGGCTATGGTGTGGGTC
ACAGTGAATCAGACAAGTCGTCCACGCATGGTGAAGGGGCAGCTGAAGCGGATGACAAGACTGTGTGGGAGGACACGGAC
CTGGGGCTGTACAAGGTCAATGAGTATGTGGACGTGCGTGACAATATCTTCGGTGCATGGTTTGAGGCCCAGGTGGTCCA
GGTACAGAAGAGAGCCCTATCTGAGGACGAGCCCTGT
Sequence Type mRNA
Unitrap ID UNI7686

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56444507..56450200 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001228 (Uhrf1) NM_010931 ubiquitin-like, containing PHD and RING finger domains, 1 Gene [Source:MGI (curated);Acc:Uhrf1-002]

 
Come back to gene ENSMUSG00000001228


For any suggestions or comments, please send an email to unitrap@crg.es