Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286382
Clone ID OST286382
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286382
Sequence
ACTGAGGTGGGGTCTTTCACTGGGNATCGCCGNCCTGCACCACCATAGTGCCAAGCCAGTACAGGCAACTTCCACCAGGC
TGCTCCAGAGAAGNCCCTGACAAGATGGTGNTTGGCTTGGGATCCAGAGATGTCCNNATCCTGTCTTCCACTGTGGCAGA
TTCTTTCTGCAGCTCTGCCACCTTGTAGGGTGCTGGTTTTCTGCTCTACAGACGGAGACGGAAGTGACTACCTGAAGGAA
GGCATAGGGTGTGCTCCAGAACCTGGGACATTCAGGCTCCCAGGCTTCCCACACAAGCCTAGCCACACCACTTCTCCTCC
CAGCGGGGCAAGCCCTGTGCCCCAGACCTGCTCTATGGGGTTGGGGAGGGGGTTTTACTGGAAAGCCCTGCTGGCCTAGG
CTTCAGCCTCACACAGCTGGTGTTCTGGGAGTGAATANCACTGCCCTCTGGTGGTGAGTTGAAACCTTTGCTCTTGGAAT
GCTCATCTGAGAAAACAAAAACTGTAGAATGGGG
Sequence Type mRNA
Unitrap ID UNI20095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30746628..30747119 471
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050737 (Ptges) NM_022415 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges-001]

 
Come back to gene ENSMUSG00000050737


For any suggestions or comments, please send an email to unitrap@crg.es