Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0179
Clone ID AQ0179
Vector pGT0lxr
Project sanger

Sequence tag AQ0179
Sequence
CTAGCTTCCCTTTGCCGGCTGGTGCGTACGTTGTAGTCCCCCGAGGCCATGTCAGGAGACGCAGCCGCGGAGCAG
Sequence Type mRNA
Unitrap ID UNI530

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104430785..104430859 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027176 (Cstf3) NM_145529 cleavage stimulation factor, 3' pre-RNA, subunit 3 Gene [Source:MGI (curated);Acc:Cstf3-001]

 
Come back to gene ENSMUSG00000027176


For any suggestions or comments, please send an email to unitrap@crg.es