Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286155
Clone ID OST286155
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286155
Sequence
GACTGAGCTCCCTTGGCAGCCCTGGCATCACTCAAGGGAGACATTGTAGAGCTGAATAAGCGTCTGCAGCTGACAGAGCG
GGAACGCGACCTCCTGGAAAAGAAGTTGGCCAAAGCACAGTGTGAGCAGTCACACCTCATGAGAGAGCATGAAGACGTCC
AGGAGCCGCACGACACTCCGCTATGAGGAGCCGCATCACAGAACTCCACAGTATCATTGCAGAACTCAACAAGAAGATAG
ACCGCCTGCAAGGTACCACCATCAGGGAGGAAGATGAGTACTCAGAACTTCGGTCAGAGCTCAGCCAGAGTCAACAAGAG
GTTAATGAAGACTCCAGAAGTGTGGGCCAAGACCAGACCTCTGTGTCCATCCCTGANAACCAGTCTACTATGGTCACTGC
TGATATGGGTGAGTCTTCCCAGGCCTCTTGCTAAACAGGAGTTTAGTTTCTGGGCTGTAAGAGAAACCCCAGAAACACAA
GACAGCCCAAACGAAGATTTATATATTTAAGG
Sequence Type mRNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44669648..44693956 245
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es