Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286060
Clone ID OST286060
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286060
Sequence
GCTTGCCACATGAAAAACACCATAACCANCCTTACTGTGGCATTGCACCATACATCCGAGAGTTTGAGGACCCTNGAGAT
GCTCCTCCTCCAACAAGAGCAGAAACCCGGGAAGAACGCATGGAGAGAAAGAGACGGGAAAAAATTGAACGGCNACAGNA
GGAAGTGGAGACAGAGCTGAAAATGTGGGACCCTCACAATGATCCCAATGCTCAGGGCGGATGCCTTCAAGACTCTGTTC
GNGGCTAGAGTGAACTATGACACAACAGAATCTAAGCTTCGGAGAGAGTTTGAGGTGTATGGACCCATCAAAAGAATCCA
CATGGTATACAGNAAACGCTCTGGAAAACCCCGTGGTTATGCCTTCATCGAGTATGAGCATGAACCGAGACATGCACTCC
GCTTACAAGCACGCA
Sequence Type mRNA
Unitrap ID UNI11845

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52636172..52650093 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es