Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST286029
Clone ID OST286029
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST286029
Sequence
CATGATCCCACCTCCCCCCAGTCTCCCGGGCCCTCCTCGGCCTGGCATGATGCCTGCCCCCCACATGGGAGGCCCTCCCA
TGATG
Sequence Type mRNA
Unitrap ID UNI19066

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27982192..27984956 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024217 (Snrpc) NM_011432 U1 small nuclear ribonucleoprotein C Gene [Source:MGI (curated);Acc:Snrpc-001]

 
Come back to gene ENSMUSG00000024217


For any suggestions or comments, please send an email to unitrap@crg.es