Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AN0062
Clone ID AN0062
Vector pGT0lxr
Project sanger

Sequence tag AN0062
Sequence
CAGCCGGCGCGTGAAGGTGCGGATTCCGGGCTTCCGGGTGGGCGTGGGGGCCGGACGAGCTAGGGGTCGGCGGCGTGGCA
AGAGGACAGGGCTATGGAGAAGCTGCGGCGCGTCTTGAGCGGCCAGGACGACGAGGAGCAAGGCCTGACGGCGCAG
Sequence Type mRNA
Unitrap ID UNI4921

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 8503997..8504150 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073468 (Sft2d1) SFT2 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1918689]

 
Come back to gene ENSMUSG00000073468


For any suggestions or comments, please send an email to unitrap@crg.es