Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285746
Clone ID OST285746
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285746
Sequence
GCCAGGATGTTGGTGNTCTGGCTGGTCTCTTTGTGGTCCACATTGCCACTGCCATTATGCTGTTTGTCTCCACCATTGCC
AACGTCTGGATGGTTGCAGATTACGCAAATGCATCTGTAGGGCTTTGGAAGAACCTGCACCTGGTGGTAACCTGCGACGG
CCTCCCTGTCCTACGGCAATGAAGATGCTATCAAGGCAGTGCAAGCCTTCATGATCCTCTCCATCATCTTCTCCATCATC
TCCCTTGNGGTCTTCGTGTTCCAGCTCTTCACTATGGAGAAGGGAAACCCGGTTCTTCCTCTNAGGGTCCACCATGCTGG
Sequence Type mRNA
Unitrap ID UNI22747

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 135327223..135330253 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030208 (Emp1) NM_010128 epithelial membrane protein 1 Gene [Source:MGI (curated);Acc:Emp1-001]

 
Come back to gene ENSMUSG00000030208


For any suggestions or comments, please send an email to unitrap@crg.es