Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0291
Clone ID AM0291
Vector pGT0lxr
Project sanger

Sequence tag AM0291
Sequence
AGACAACACCACCTCATGTTATCGGTCAGTTGGACAAACTGATTAGAGAGGTGTCTACCTTGGATGGGGTGCTAGAAGTC
CGAAATGAACACTTTTGGACCCTTGGATTTGGCTCATTG
Sequence Type mRNA
Unitrap ID UNI4277

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74817958..74818940 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es