Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AJ0651
Clone ID AJ0651
Vector pGT0lxr
Project sanger

Sequence tag AJ0651
Sequence
GGAGTCTGCATCCATCCGGAGTCTGCATCCATCCATCCATCCAATCACTTTTTCTATGTTTTATGCCAGCACTGAGGTGG
ACGGGGAGCATTACATGACTCCAGAAGACTTCGTTCAACGCTATCTTGGCCTGTACAACGATCCAAACAGCAACCCAAAG
ATTGTGCAGCTCTTGGCAGGAGTAGCTGATCAAACCAAGGATGG
Sequence Type mRNA
Unitrap ID UNI4925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 71181947..71185885 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027010 (Slc25a12) NM_172436 solute carrier family 25 (mitochondrial carrier, Aralar), member 12 Gene [Source:MGI (curated);Acc:Slc25a12-001]

 
Come back to gene ENSMUSG00000027010


For any suggestions or comments, please send an email to unitrap@crg.es