Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285379
Clone ID OST285379
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285379
Sequence
AGACACCCTGCTGTGGACCTGTATTCTTGGCACCAGTGGCTGCCACTCTCTGACAGAGTCTACAGTGTAGCCGNCTGCTC
TACATCCTCCTCCACGTGGGAGCCTCAGCAATCTGCTGCCTCCTGCTTTCGAAGACAGTGGTAGAAAGGGTCTGGGGCAA
AGCACATGGGATCCAGATGCCCTCAGTGCTATGTGCCCACCTGTTTGGCAGCTCGGACTGTCCAGTTCTCAGTGGCCCTG
GCGCTGAG
Sequence Type mRNA
Unitrap ID UNI22760

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121281502..121281893 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046110 (Serinc4) NM_001025371 serine incorporator 4 Gene [Source:MGI (curated);Acc:Serinc4-001]

 
Come back to gene ENSMUSG00000046110


For any suggestions or comments, please send an email to unitrap@crg.es