Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285314
Clone ID OST285314
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285314
Sequence
GACTGAGGCTTTGAAGAGGAAGGAGGCGATCCAGATAATATTGAATTAACTGTTTCAACTGATACTCCAAACAAGAAACC
AACCAAAGGCAAAGGTTGTTACCGAGTTCTGAACATATTTNANANTATATTNTGGTTCTATAAGAATGAANNCTNNNGAA
AAGGACGTGTGAATTGGAGAATCAAGAGACACATGACCAAGATGGAAATGAAGAGCTTAAAGGACTTGGAAGAATTTGGT
GAAAATGAAGAGGAAATTGTGCATTCCCAGGAGTTGCTTTCTACAGAAGAGAACAAGACAACTCAGGAATTTGTAGAGGC
AGAAGCAATAGAAGATAGAGAAAAAGAGGACATCGAAAGTCAGGAAACTGAAGCTCAAGAAGGNGAAGATGACACCTTTC
TAACAGCCCAAGATGGTGAGGAAGAAGAAAATGA
Sequence Type mRNA
Unitrap ID UNI22761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70391775..70419978 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032212 (Sltm) NM_025690 SAFB-like, transcription modulator Gene [Source:MGI Symbol;Acc:MGI:1913910]

 
Come back to gene ENSMUSG00000032212


For any suggestions or comments, please send an email to unitrap@crg.es