Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285307
Clone ID OST285307
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285307
Sequence
GACTGAGGCTTTGCTGGTCCTTCTCAGTTAGATAGCATTGATCTCTGGAATCCTGACGCTCCTGTAGAGACATTCTGGGA
AATCAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGCCATCAAATGCTTAGTAGCACAGAAATTCTCAAGT
GGTTACGGGAAATTCTGATCTGCAGAAATAAATTTCTTCTTAAAAATAAAAAA
Sequence Type mRNA
Unitrap ID UNI22763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79248345..79250314 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020716 (Nf1) NM_010897 neurofibromatosis 1 Gene [Source:MGI (curated);Acc:Nf1-003]

 
Come back to gene ENSMUSG00000020716


For any suggestions or comments, please send an email to unitrap@crg.es