Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285241
Clone ID OST285241
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285241
Sequence
GACTGAGGCGTGCTGAGTCTGCAGGCATTTTCCAACATGGACCTCCGAGACTTCCACAAGTACATGAGGAGCCATAAGGC
AGAATCCAATGAGCTGNTGAGGAACAGCCACCACACATGGCTCCACCAGGGAGAGGGAGCACATCACGTCATGCAGTGCC
ATCCGCCAGAGGGTCCTGCGCCTCACTCGCCTCTCCCCGGAGATTGTGGAGTTCAGTGAGCCACTACAGGTTGTACGATA
TGGTGAGGGAGGTCACTACCATGCCCATGTGGACAGCGGACCCGTGTACCCAGAGACCATCTGCTCCCATACCAAGCTGG
TAGCCAATGAATCTGTACCGTTTGAGACCTCCTGTNGCTACATGACAGTGCTGTTTTATTTGAACAATGNCACCGGNGGG
GGTGAGACCGTCTTCCCTGTGGCANACAACAGGACCTATGANGAAATGAGTCTGATTCAGGATGATGTCGATCTCCGGGA
CACTCGAAGGCACTGTGAC
Sequence Type mRNA
Unitrap ID UNI22770

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108482120..108484337 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006675 (4933406E20Rik) NM_028944 RIKEN cDNA 4933406E20 gene Gene [Source:MGI Symbol;Acc:MGI:1921693]

 
Come back to gene ENSMUSG00000006675


For any suggestions or comments, please send an email to unitrap@crg.es