Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285144
Clone ID OST285144
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285144
Sequence
ACTGAGGAGATTAAGTGAAAGAGAGAGGATTGGAGAATTGGGAGCTCCTGAAGTTTGGGGACTTTCCCCAAAGAATCCTG
AACCAGAGTAAGTGTGTTTAAAAAAAAAATTA
Sequence Type mRNA
Unitrap ID UNI22776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34670971..34671078 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016409 (Nkap) NM_025937 NFKB activating protein Gene [Source:MGI (curated);Acc:Nkap-001]

 
Come back to gene ENSMUSG00000016409


For any suggestions or comments, please send an email to unitrap@crg.es