Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST285056
Clone ID OST285056
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST285056
Sequence
CCTCTGCCGCTCTCACNCCTGAAGGACACATTCTCTGCAGGACCACTATGAAAGACTCATTGACGTATTGCACGACCTGA
GCTGCTGGATTAGGAGTGGACTTGGGCAGGTTTTTCTCATGCTTTGGAGACATGTAATAGTCTTGAAGCACCTTTGCACC
AAATGGAAGAGTACATTTCTTTGTTGTCGATAGAACAACTGTTACAATAATAAATTTCATAAATTAATGGCAAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI11490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154161116..154161349 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027487 (Cdk5rap1) NM_025876 CDK5 regulatory subunit associated protein 1 Gene [Source:MGI (curated);Acc:Cdk5rap1-001]

 
Come back to gene ENSMUSG00000027487


For any suggestions or comments, please send an email to unitrap@crg.es