Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST284897
Clone ID OST284897
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST284897
Sequence
ACTGAGGTTAGGCCGGGGCTTGGGNTTCACCATGGCAACTGAAGAGGCCATCATCCGCATCCCCCCATACCACTACATCC
ATGTGCTGGACCAGAACAGTAATGTGTCCCGTGTAGAGGTTGGACCAAAGACCTACATCCGGCAGGACAATGAGAGGGTA
CTGTTTGCCCCAGTTCGCATGGTGACNGGTCCCACCACCGCCACTACTGCATAGTGGCCAACCCTGTGTCCCGGGACGCC
CAGAGTTCTGTGTTGTTTGACGTCACAGGACAAGTCCGGCTCCGGCACGCTGACCAGGAGATCCGACTAGCCCAGGACCC
CTTCCCTCTGTACCCAGGGGAGCTGCTGGAAAAGGACATCACCCCGCTGCAGGTGGTTCTGCCCAACACTGCCCTGCATC
TGAAGGCATTGCTGGACTTTGAAGATAAGAATGGAGACAAGGTCATGGCAGGAGACGAGTGGCTGTTTGAGGGACCTGGC
ACCTACATCCCACAGAAGGAGGTGGAAGTCGTGGAGATCATTCATAG
Sequence Type mRNA
Unitrap ID UNI19344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134141826..134145474 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030681 (Mvp) NP_542369 major vault protein Gene [Source:MGI (curated);Acc:Mvp-001]

 
Come back to gene ENSMUSG00000030681


For any suggestions or comments, please send an email to unitrap@crg.es