Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST284767
Clone ID OST284767
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST284767
Sequence
GACTGAGGATCTTGGGTCTTTGCAACAATTTCTCATATGTGGTGATGCTGAGCGCTGCCCATGACATCCTCAAGCAGGAG
CAGGCGTCTGGAAACCAGAGCCATGCAGAACCAGNACCAACACANCACANCCCAACCANTAGCCTNATAATCNATCTGGA
CGTGCTAATTGGCATTTCACATAGCTGCCGTTAGCATCCNTANCGAGGACGNTTCCTTTCACCANNCNGTTTGTGATCNN
ANTCCNGCNNCCNTTCTTGGCCTTCNNTTGTTGCCTTACAGCCCNAAGGGCTGCTCTGTGAGTGGAGTTTGTTACTGTTG
GNAGCTTTGTNNTGGANGCCTTCTNTCANTCANTGNNNGTNNTCNNGTGTAGGAGCTGGTTATTGGCACAGGCATNTCNC
TCAGGNNCTAGGGGAGGCNACCTTNCTNTNACTGACTGCCTNCTACCCCAGTGCTGAGATNTCATGGTGNCCTTNGGANA
CCGTAGNTGCAATGCTTCTGAGGATCTGCTGTCTTACCTGGGACTCAC
Sequence Type mRNA
Unitrap ID UNI21977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 133722756..133725258 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030720 (Cln3) NM_009907 ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) Gene [Source:MGI (curated);Acc:Cln3-002]

 
Come back to gene ENSMUSG00000030720


For any suggestions or comments, please send an email to unitrap@crg.es