Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST284486
Clone ID OST284486
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST284486
Sequence
GACTGAGGGATGCCCTGGACGCTCTGGGCCTAAAGCGCTACTGCTGCCGCCGCATGCTGCTAGCACACGTGGACCTGATT
GAGAAGCTGCTGAACTATGCACCCCTAGAGAAGTGACCGCTGGAGCCTGCCCTCCTCTGTCTCCTGCTGGCCACGGGCAG
CCTGTCGTGCTATGTTCAAACTGAGCTATTGGGGGATGTTGGTGTATTGCCTGGCTGTGGCCCTGTGGCTAAGTCCTGTT
ACCCTGGAAGGAACTGTTTAGTAAAGATGTTTGCAGAACCACCA
Sequence Type mRNA
Unitrap ID UNI10358

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148659028..148659305 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038489 (Polr2l) polymerase (RNA) II (DNA directed) polypeptide L Gene [Source:MGI (curated);Acc:Polr2l-001]

 
Come back to gene ENSMUSG00000038489


For any suggestions or comments, please send an email to unitrap@crg.es