Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0117
Clone ID AM0117
Vector pGT0lxr
Project sanger

Sequence tag AM0117
Sequence
GTTGTGAGCTCTTCTAGATGGTTTCTCTGCGGTGTGTCCTGAGTGCCTCTGCTGGGTGCTCTGAGGGAGCTCTGAAAAGC
TTAAAATTTCCGGACATG
Sequence Type mRNA
Unitrap ID UNI4658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150007524..150007606 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079009 (EG245174) predicted gene, EG245174 Gene [Source:MGI Symbol;Acc:MGI:3644476]

 
Come back to gene ENSMUSG00000079009


For any suggestions or comments, please send an email to unitrap@crg.es