Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AL0615
Clone ID AL0615
Vector pGT0lxr
Project sanger

Sequence tag AL0615
Sequence
GCATTTGTGATTCTCCAAACTCTGCGGCGTTCTCAAAGTTCGGACAGTGTGGCTTGTTCTTCGCGCTTAACATGGAG
Sequence Type mRNA
Unitrap ID UNI627

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67914757..67914833 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030446 (Zfp273) NP_938081 zinc finger protein 273 Gene [Source:MGI Symbol;Acc:MGI:3036278]

 
Come back to gene ENSMUSG00000030446


For any suggestions or comments, please send an email to unitrap@crg.es