Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AM0868
Clone ID AM0868
Vector pGT0lxr
Project sanger

Sequence tag AM0868
Sequence
GTGGTTGTGAGCTTTTCTAGAGGGTGGTTGAGAGCTCTTATAGATTGTGGTTGTGAGCTCTTCTAGATGGTTTTGGCTAT
GGAAAGGGGAAATGTACTAACCAAGGTCCTTCGGGAGCCCCTGAGACGCGCTTTGGAGGTGACAAACTTGAAGACCTTGA
AGAAGCCAATCCATTCTCCTTCAAAGAGTTTTTGAAAACCAAGAACCTCAGCCTGTCAAAAGAAGACACGACCACCAGCC
GAATTTACCCAAAG
Sequence Type mRNA
Unitrap ID UNI4937

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26243076..26244091 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026927 (Sdccag3) NP_080839 serologically defined colon cancer antigen 3 Gene [Source:MGI (curated);Acc:Sdccag3-002]

 
Come back to gene ENSMUSG00000026927


For any suggestions or comments, please send an email to unitrap@crg.es